| Sequence ID | >W1511431851 |
| Genome ID | JUFX01000010 |
| Phylum/Class | Alphaproteobacteria |
| Species | Komagataeibacter intermedius AF2 [JUFX] |
| Start position on genome | 75000 |
| End posion on genome | 75075 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
acggcccggt |
| tRNA gene sequence |
GCCCAAGTAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGTCGGTGGTTCGATC |
| Downstream region at tRNA end position |
tttcatttcc |
| Secondary structure (Cloverleaf model) | >W1511431851 Phe GAA
t ACCA tttcatttcc
G - C
C - G
C - G
C - G
A - T
A - T
G - C C T
T C C G C C A
T G A A | | + | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T A A GTGTC
T - A
G - C
C - G
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |