Sequence ID | >W1511441968 |
Genome ID | JURC01000039 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Haemophilus influenzae 839_HINF [JURC] |
Start position on genome | 17828 |
End posion on genome | 17734 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tttcaaccac |
tRNA gene sequence |
GGAAGGTCGTCATCTCCGGTGAGGTGGCAGGACTTCAAATCCTGTTGGGGACGCCAGCGT |
Downstream region at tRNA end position |
atctatataa |
Secondary structure (Cloverleaf model) | >W1511441968 SeC TCA c GCCA atctatataa G - C G - C A - T A - T G - C G - C T - A C - G T C G T A C C C A C C T T + | | | | A G C T A C G T G G G C G | + | | T T T G G T G G A G TTGGGGACGCCAGCGTTCCCGG C - G A - T G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |