Sequence ID | >W11126321 |
Genome ID | ADWO01000015 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Segatella baroniae B14 [ADWO] |
Start position on genome | 12118 |
End posion on genome | 12042 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ccggaactat |
tRNA gene sequence |
AGTCCTATAGCTCAGTTGGTTAGAGCGCCACACTGATAATGTGGAGGTCGGCAGTTCAAG |
Downstream region at tRNA end position |
aaacttccag |
Secondary structure (Cloverleaf model) | >W11126321 Ile GAT t ACAA aaacttccag A - T G - C T - A C - G C - G T + G A - T T G T C C G T C A T G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G C - G A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |