Sequence ID | >W1511449442 |
Genome ID | JVBA01000062 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium striatum 587_CAUR [JVBA] |
Start position on genome | 20886 |
End posion on genome | 20810 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gggaatacgc |
tRNA gene sequence |
GGGGCTATAGCTCAGTCGGTTAGAGCTACGGACTCATAATCCGTTGGTCCCAGGTTCGAG |
Downstream region at tRNA end position |
cgcaaagctt |
Secondary structure (Cloverleaf model) | >W1511449442 Met CAT c ACAA cgcaaagctt G - C G - C G - C G - C C - G T + G A - T C G T G G C C C A T G A A | | | | G C C T C G C C A G G C G | | | | T T G G A G C T T A T TGGTC A - T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |