Sequence ID | >W11127103 |
Genome ID | ADXD01000039 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter wiegelii Rt8.B1 [ADXD] |
Start position on genome | 3736 |
End posion on genome | 3652 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aataaagcgt |
tRNA gene sequence |
GCGGTGGTGGCGGAACTGGCAGACGCGTACGTTTGAGGGGCGTATGGGGTTTCCCGTGTG |
Downstream region at tRNA end position |
taaataaaag |
Secondary structure (Cloverleaf model) | >W11127103 Leu GAG t ACCA taaataaaag G - C C - G G - C G - C T T G - C G - C T G T C A C C C A C A A G | | | | | A T G G C G G T G G G C G | | | T T G A C G C C A G G TGGGGTTTCCCGT T - A A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |