Sequence ID | >W1511458932 |
Genome ID | JVJW01000048 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Oligella urethralis 368_TASI [JVJW] |
Start position on genome | 7754 |
End posion on genome | 7838 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcagtcaaat |
tRNA gene sequence |
GCCCGGGTGGTGAAATTGGTAGACGCAGGGGACTCAAAATCCCCCGCCGCAAGGCGTGCC |
Downstream region at tRNA end position |
caaatccctc |
Secondary structure (Cloverleaf model) | >W1511458932 Leu CAA t ACCA caaatccctc G - C C - G C - G C - G G - C G - C G - C T G T C G G C C A T A A G | | | | | A T A G T G G C C G G C G | + | T T G A C G C T A G A CGCCGCAAGGCGT G - C G - C G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |