Sequence ID | >W11128583 |
Genome ID | ADYN01000036 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cutibacterium acnes HL013PA2 [ADYN] |
Start position on genome | 29573 |
End posion on genome | 29645 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tctccacctc |
tRNA gene sequence |
GGGCGGTTGGCGCAGTGGTAGCGCGCTTCCCTGACACGGAAGAGGTCGCCAGTTCAAACC |
Downstream region at tRNA end position |
agcagggttg |
Secondary structure (Cloverleaf model) | >W11128583 Val GAC c ACag agcagggttg G - C G - C G - C C - G G - C G + T T - A C A T C G G T C A G A G | | | | | A T C G C G G C C A G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |