Sequence ID | >W11129488 |
Genome ID | ADZH01000026 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cutibacterium acnes HL013PA1 [ADZH] |
Start position on genome | 18404 |
End posion on genome | 18330 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggatcacatt |
tRNA gene sequence |
GGCGGGGTAGCTCAGGGGTAGAGCAAGCGGCTCATAATCGCTGTGTCGCGGGTTCGATTC |
Downstream region at tRNA end position |
atttaaccgg |
Secondary structure (Cloverleaf model) | >W11129488 Met CAT t ACCA atttaaccgg G + T G - C C - G G - C G - C G - C G + T T T T C G C C C A G A A | | | | | G G C T C G G C G G G C G | | | | T T G G A G C T A A GTGTC A - T G - C C - G G - C G + T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |