Sequence ID | >W1511473332 |
Genome ID | JWAI01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Alloscardovia omnicolens 1173_BLON [JWAI] |
Start position on genome | 16481 |
End posion on genome | 16571 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gtaaagtact |
tRNA gene sequence |
GTCCGGGTGGCGGAATGGTAGACGCGCTAGCTTGAGGTGCTAGTGCCCATTTTATACGGG |
Downstream region at tRNA end position |
tttcaaggat |
Secondary structure (Cloverleaf model) | >W1511473332 Leu GAG t ACAA tttcaaggat G - C T - A C - G C - G G - C G - C G + T T G T C G C C C A T A A G | | | | | A G G G C G G C G G G C G | | | T T T A C G C A G G TGCCCATTTTATACGGGCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |