Sequence ID | >W1511480167 |
Genome ID | JWIS01000010 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Eubacterium limosum ATCC 8480 [JWIS] |
Start position on genome | 16835 |
End posion on genome | 16761 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
agattaataa |
tRNA gene sequence |
GCGGAAGTGGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGAGTTCAAATC |
Downstream region at tRNA end position |
tttttaaggt |
Secondary structure (Cloverleaf model) | >W1511480167 Gly GCC a TCCA tttttaaggt G - C C - G G - C G - C A - T A - T G - C T A T T G C T C A G A G + | | | | A T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |