Sequence ID | >W1511481067 |
Genome ID | JWJO01000021 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Myroides marinus L41 [JWJO] |
Start position on genome | 21251 |
End posion on genome | 21175 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
actttgagtc |
tRNA gene sequence |
GCCGGTGTAGCTCAGCTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
aagttttctt |
Secondary structure (Cloverleaf model) | >W1511481067 Thr TGT c TCAA aagttttctt G - C C - G C - G G - C G + T T - A G - C T G T C T C C C A C G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |