Sequence ID | >W1511483570 |
Genome ID | JWLX01000004 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alteromonas macleodii AD006 [JWLX] |
Start position on genome | 77840 |
End posion on genome | 77764 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agaatagcaa |
tRNA gene sequence |
GGCTACGTAGCTCAGTTGGTTAGAGCACATCACTCATAATGATGGGGTCGCAAGTTCGAA |
Downstream region at tRNA end position |
attctcactt |
Secondary structure (Cloverleaf model) | >W1511483570 Met CAT a ACCA attctcactt G - C G - C C - G T - A A - T C - G G - C T A T C G C T C A T G A A | | | | G T C T C G G C A A G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |