Sequence ID | >W11135405 |
Genome ID | AEEX01000219 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa 39016 [AEEX] |
Start position on genome | 81165 |
End posion on genome | 81241 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gatgaataaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCATCCGCCTTCTAAGCGGATGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
ttcggcgaat |
Secondary structure (Cloverleaf model) | >W11135405 Arg TCT a GCCA ttcggcgaat G - C C - G G + T C - G C - G C - G G - C T G T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A TGGTC T - A C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |