| Sequence ID | >W11135546 |
| Genome ID | AEFB01001295 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus sp. GGI-221 [AEFB] |
| Start position on genome | 864 |
| End posion on genome | 950 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
ttggtatttt |
| tRNA gene sequence |
GCCGGGATGGCGGAACTGGTAGACGCGCCGGACTCAAAATCCGGTGGTGGTGACATCGTG |
| Downstream region at tRNA end position |
ttatttaagt |
| Secondary structure (Cloverleaf model) | >W11135546 Leu CAA
t ACCA ttatttaagt
G + T
C - G
C - G
G - C
G + T
G - C
A - T T G
T C A G C C A
C A A G | | | | | G
T G G C G G T C G G C
G | | | T T
G A C G C
T A G G TGGTGGTGACATCGT
C - G
C - G
G - C
G - C
A - T
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |