Sequence ID | >W1511503348 |
Genome ID | JXHO01000031 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus subtilis B4072 [JXHO] |
Start position on genome | 5429 |
End posion on genome | 5346 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccattaacaa |
tRNA gene sequence |
GGGTGAGCGGTAACGTTGGAGAGTTACGGCAGACTGTAAATCTGCTCCCTTCGGGGTTAG |
Downstream region at tRNA end position |
cacactgtgc |
Secondary structure (Cloverleaf model) | >W1511503348 Tyr GTA a Attg cacactgtgc G - C G - C G - C T - A G + T A - T G - C T A C C T C A C A T T G C G | | | | | G G A A T G G A G T G C G | | | | T T A T T A C G A G G TCCCTTCGGGGTTA G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |