Sequence ID | >W1511504551 |
Genome ID | JXIJ01000014 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Mastigocladus laminosus UU774 [JXIJ] |
Start position on genome | 120729 |
End posion on genome | 120658 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gactgtttgt |
tRNA gene sequence |
GCCGATGTGGCTCAGTGGTAGAGCACTCGATTCGTAATCGAGCGGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
ttcagttaac |
Secondary structure (Cloverleaf model) | >W1511504551 Thr CGT t Ttat ttcagttaac G - C C - G C - G G - C A - T T - A G - C T A T C G C C C A G A G | | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A CGGTC C - G T - A C - G G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |