Sequence ID | >W1511504599 |
Genome ID | JXIJ01000153 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Mastigocladus laminosus UU774 [JXIJ] |
Start position on genome | 248334 |
End posion on genome | 248261 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
acaaaagtgc |
tRNA gene sequence |
GGACGTATAGCTCAGTTGGTTAGAGCGCTACGTTGACATCGTAGAGGTCACTGGTTCGAA |
Downstream region at tRNA end position |
tactttttgt |
Secondary structure (Cloverleaf model) | >W1511504599 Val GAC c Attt tactttttgt G - C G - C A - T C - G G - C T - A A - T T A T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |