Sequence ID | >W1511508612 |
Genome ID | JXQJ01000009 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella pectinovora P5-60 [JXQJ] |
Start position on genome | 25057 |
End posion on genome | 25143 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tccagaagat |
tRNA gene sequence |
GCCGCAATGGTGGAATTGGTAGACACGAGGGACTTAAAATCCCTTGGCCAGGAATGGCCG |
Downstream region at tRNA end position |
atttaatatc |
Secondary structure (Cloverleaf model) | >W1511508612 Leu TAA t ACat atttaatatc G - C C - G C - G G - C C - G A C A - T T G T C G C C C A T A A G | | | | | G T G G T G G C G G G C G | | | T T G A C A C T A G G TGGCCAGGAATGGCCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |