Sequence ID | >W11138954 |
Genome ID | AEJM01000019 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aggregatibacter actinomycetemcomitans serotype e str. SC1083 [AEJM] |
Start position on genome | 21399 |
End posion on genome | 21488 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcctaatcac |
tRNA gene sequence |
GGTGAGATGTCCGAGTGGTTGAAGGAGCACGCCTGGAAAGCGTGCATGTGGGAAACTGCA |
Downstream region at tRNA end position |
tttatcaatt |
Secondary structure (Cloverleaf model) | >W11138954 Ser GGA c GCCA tttatcaatt G - C G - C T - A G - C A - T G - C A - T T A T C C C C C A T G A G | | | | | G G G C C T G G G G G C G | | | T T T A G G A T G A G CATGTGGGAAACTGCATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |