| Sequence ID | >W11139461 |
| Genome ID | AEKD01000008 |
| Phylum/Class | Bacillota |
| Species | Caldicellulosiruptor acetigenus 6A [AEKD] |
| Start position on genome | 3329 |
| End posion on genome | 3405 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
taaagaggcg |
| tRNA gene sequence |
GTGGATATAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCATGGGTTCGAG |
| Downstream region at tRNA end position |
ttttaaatta |
| Secondary structure (Cloverleaf model) | >W11139461 His GTG
g CCCA ttttaaatta
G - C
T - A
G - C
G - C
A - T
T - A
A - T T G
T T A C C C A
T G A A | | | | | G
T C T C G A T G G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
C - G
A - T
G - C
G - C
T C
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |