Sequence ID | >W1511524716 |
Genome ID | JYFN01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Frankia torreyi CpI1-S [JYFN] |
Start position on genome | 191910 |
End posion on genome | 191836 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tgccgttgta |
tRNA gene sequence |
CGGGACGTGGCGCAGCTTGGTAGCGCACCAGACTGGGGGTCTGGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
gggtgagggg |
Secondary structure (Cloverleaf model) | >W1511524716 Pro GGG a ACac gggtgagggg C - G G - C G - C G - C A - T C - G G - C T A T T G T C C A C G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G A - T G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |