Sequence ID | >W1511525857 |
Genome ID | JYGJ01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus cristatus CC5A [JYGJ] |
Start position on genome | 444739 |
End posion on genome | 444668 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aagtaagttg |
tRNA gene sequence |
CCACCCTTAGTGTAATGGATATCACGTAAGATTCCGGTTCTTGAGATGGGAGTTCGATTC |
Downstream region at tRNA end position |
ctaaagcttg |
Secondary structure (Cloverleaf model) | >W1511525857 Arg CCG g Atga ctaaagcttg C - G C - G A - T C - G C - G C - G T - A T T T C T C T C A T A A A | + | | | G G T G T G G G G A G C G | | | T T A T C A C T A G AGAT T + G A - T A - T G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |