Sequence ID | >W1511529564 |
Genome ID | JYJR01000015 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus 10-4244 [JYJR] |
Start position on genome | 281 |
End posion on genome | 356 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttgaaacaat |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
tctttaagcg |
Secondary structure (Cloverleaf model) | >W1511529564 Val TAC t ACCA tctttaagcg G - C G - C G - C C - G G - C A - T T - A C G T T G G C C A T G A A | | + | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |