Sequence ID | >W1511533280 |
Genome ID | JYMR01000045 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium sp. LTSP849 [JYMR] |
Start position on genome | 328362 |
End posion on genome | 328448 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
caaacggcat |
tRNA gene sequence |
GCCCAGGTGGTGGAATTGGTAGACGCGCTGGCTTCAGGTGCCAGTGGCTTAACGGCCGTG |
Downstream region at tRNA end position |
ttttgcagaa |
Secondary structure (Cloverleaf model) | >W1511533280 Leu CAG t ACCA ttttgcagaa G - C C - G C - G C - G A - T G - C G - C T G T T T T C C A T A A G + | | | | G T G G T G G A A G G C G | + | T T G A C G C T A G G TGGCTTAACGGCCGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |