Sequence ID | >W1511533307 |
Genome ID | JYMS01000025 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium sp. LTSP857 [JYMS] |
Start position on genome | 96378 |
End posion on genome | 96302 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aggcggcgag |
tRNA gene sequence |
GGGCGGTTAGCTCAGCTGGTTAGAGCATCTCGTTTACACCGAGAGGGTCCGCGGTTCGAA |
Downstream region at tRNA end position |
gcgccttgtc |
Secondary structure (Cloverleaf model) | >W1511533307 Val TAC g ACCA gcgccttgtc G - C G - C G - C C - G G - C G - C T - A T A T G T G C C A C G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |