Sequence ID | >W1511536216 |
Genome ID | JYPC01000020 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Operophtera brumata of Operophtera brumata Ob_Wba [JYPC] |
Start position on genome | 3842 |
End posion on genome | 3925 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attaaaatag |
tRNA gene sequence |
GCCCCTGTGGTGGAATGGTAGACACGGCAGACTCAAAATCTGTTGCTTGCAAGAGCATGC |
Downstream region at tRNA end position |
aaacattgga |
Secondary structure (Cloverleaf model) | >W1511536216 Leu CAA g ACtc aaacattgga G - C C - G C - G C - G C - G T - A G - C T G T C G G C C A T A A G | | + | | A G G G T G G C T G G C G | | | T T T A C A C A G G TGCTTGCAAGAGCAT G + T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |