Sequence ID | >W1511536234 |
Genome ID | JYPC01000104 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Operophtera brumata of Operophtera brumata Ob_Wba [JYPC] |
Start position on genome | 6052 |
End posion on genome | 5980 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
atatctagag |
tRNA gene sequence |
GGGCAATTAGCTCAGCTGGTAGAGCATCTCGTTTACACCGAGGAGGTCGGCAGTTCAAGT |
Downstream region at tRNA end position |
gcctagttga |
Secondary structure (Cloverleaf model) | >W1511536234 Val TAC g Atta gcctagttga G - C G - C G - C C - G A - T A - T T - A T G T C T G T C A C G A A | + | | | A T C T C G G G C A G C G | | | | T T G G A G C T A A AGGTC T + G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |