Sequence ID | >W1511536235 |
Genome ID | JYPC01000105 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Operophtera brumata of Operophtera brumata Ob_Wba [JYPC] |
Start position on genome | 2232 |
End posion on genome | 2159 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gtacgtagtt |
tRNA gene sequence |
GGCCTGATAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGCTGGTTCGATT |
Downstream region at tRNA end position |
tctttttctt |
Secondary structure (Cloverleaf model) | >W1511536235 Phe GAA t ACat tctttttctt G - C G - C C - G C - G T - A G - C A - T T T T C G T C C A T G A A | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |