Sequence ID | >W1511542132 |
Genome ID | JZHA01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Stenotrophomonas maltophilia #19 [JZHA] #19 [JZHA] |
Start position on genome | 192128 |
End posion on genome | 192052 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cgcgcaatca |
tRNA gene sequence |
GTCCCAGTAGCTCAATTGGATAGAGCATCCCCCTCCTAAGGGGAAGGTTGGAGGTTCGAC |
Downstream region at tRNA end position |
gattctatgc |
Secondary structure (Cloverleaf model) | >W1511542132 Arg CCT a GCCA gattctatgc G - C T - A C - G C - G C - G A - T G - C C C T T C T C C A T A A A + | | | | G T C T C G G G A G G C G | | | | T T G G A G C A T A A AGGTT T - A C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |