Sequence ID | >W1511543022 |
Genome ID | JZIL01000006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas albilineans XaFL07-1 [JZIL] |
Start position on genome | 1399009 |
End posion on genome | 1399085 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aaagccttat |
tRNA gene sequence |
GGCCCCGTAGCTCAGCTGGATAGAGCGGTCCCCTCCTAAGGGACAGGTCGTGCGTTCAAA |
Downstream region at tRNA end position |
tcttttccct |
Secondary structure (Cloverleaf model) | >W1511543022 Arg CCT t ACCA tcttttccct G - C G + T C - G C - G C - G C - G G - C T A T C G C G C A C G A A | + | | | A T C T C G G T G C G C G | | | | T T G G A G C A T A G AGGTC G - C T - A C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |