Sequence ID | >W1511549674 |
Genome ID | JZSS01000022 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Photobacterium angustum GCSL-A10-3 [JZSS] |
Start position on genome | 17162 |
End posion on genome | 17237 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
taatacattg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGTCCCGGATTGTGATTCCGGTTGTCGCGAGTTCAAGT |
Downstream region at tRNA end position |
ttatttaggt |
Secondary structure (Cloverleaf model) | >W1511549674 His GTG g CCCA ttatttaggt G - C T - A G - C G - C C - G T - A A - T T G T T G C T C A T G A A + | | | | A T C T C G G C G A G C G | | | + T T G G A G T T A C TTGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |