Sequence ID | >W1511564899 |
Genome ID | LAEL01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Azospirillum thiophilum DSM 21654 [LAEL] |
Start position on genome | 3014396 |
End posion on genome | 3014321 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttgcaaggat |
tRNA gene sequence |
GATCCGGTAGCTCAGTCGGTAGAGCACGTGACTTTTAATCATGTGGCCGTGGGTTCGAAT |
Downstream region at tRNA end position |
accaattcaa |
Secondary structure (Cloverleaf model) | >W1511564899 Lys TTT t ACCA accaattcaa G - C A - T T - A C - G C - G G - C G - C T A T C A C C C A T G A A | | | | | G C C T C G G T G G G C G | | | | T T G G A G C T A A TGGCC C - G G + T T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |