Sequence ID | >W1511573475 |
Genome ID | LAMX01000012 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Rheinheimera sp. KL1 [LAMX] |
Start position on genome | 192689 |
End posion on genome | 192600 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agcaagcctc |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGCTGAAGGCGCACGCCTGGAAAGTGTGTTTAGGTTAACCCCTA |
Downstream region at tRNA end position |
gtttaaatga |
Secondary structure (Cloverleaf model) | >W1511573475 Ser GGA c GCCA gtttaaatga G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G + | | T T C A G G C T G A G TTTAGGTTAACCCCTAAC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |