Sequence ID | >W1511575085 |
Genome ID | LAOP01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Rickettsia endosymbiont of Ixodes pacificus of Ixodes pacificus Humboldt [LAOP] |
Start position on genome | 1059326 |
End posion on genome | 1059400 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cttctaatgt |
tRNA gene sequence |
TCCTCGGTAGCTCAGTGGTAGAGCAAACGGCTGTTAACCGTTCGGTCGCTGGTTCGAGTC |
Downstream region at tRNA end position |
ttactcggtt |
Secondary structure (Cloverleaf model) | >W1511575085 Asn GTT t GCCA ttactcggtt T - A C - G C - G T + G C - G G - C G - C T G T C G G C C A G A A | | + | | G T C T C G G C T G G C G | | | | T T G G A G C T A A CGGTC A - T A - T C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |