Sequence ID | >W1511575103 |
Genome ID | LAOP01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Rickettsia endosymbiont of Ixodes pacificus of Ixodes pacificus Humboldt [LAOP] |
Start position on genome | 300603 |
End posion on genome | 300529 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
actttaagaa |
tRNA gene sequence |
GGCCCCTTCGTCTAGCGGTTAGGACATCACCCTTTCACGGTGGGAACACGGGTTCGAGTC |
Downstream region at tRNA end position |
ttctatattt |
Secondary structure (Cloverleaf model) | >W1511575103 Glu TTC a ACCA ttctatattt G - C G + T C - G C - G C - G C - G T - A T G T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C T A A GAAC T + G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |