Sequence ID | >W1511575106 |
Genome ID | LAOP01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Rickettsia endosymbiont of Ixodes pacificus of Ixodes pacificus Humboldt [LAOP] |
Start position on genome | 87288 |
End posion on genome | 87203 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aagttcttta |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGTCAATGGCAGCAGACTGTAAATCTGCCCGCGTAAGCGTTCGA |
Downstream region at tRNA end position |
cttaaatggt |
Secondary structure (Cloverleaf model) | >W1511575106 Tyr GTA a ACCA cttaaatggt G - C G - C A - T G - C G - C G - C G + T T A T C T T C C A T G A G | | | | | A G G C C G G A A G G C G + | | | T T T T G G C C A A A CCGCGTAAGCGTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |