Sequence ID | >W1511584708 |
Genome ID | LAVS01000030 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Rheinheimera mesophila IITR-13 [LAVS] |
Start position on genome | 27120 |
End posion on genome | 27196 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
atttttttgt |
tRNA gene sequence |
AGGGGCGTAGTTCCAATTGGTAGAACAGCGGTCTCCAAAACCGATGGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
cttatattag |
Secondary structure (Cloverleaf model) | >W1511584708 Trp CCA t GCCA cttatattag A - T G - C G - C G - C G - C C - G G - C T A T C T C C C A A A C A | + | | | G T C T T G G G G G G C T | | | | T T G G A A C G T A A TGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |