Sequence ID | >W1511589793 |
Genome ID | LBFH01000012 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium botulinum Walls 8G [LBFH] |
Start position on genome | 203 |
End posion on genome | 278 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
acttaaatat |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAGGAGTTCGAAT |
Downstream region at tRNA end position |
tttaagggtc |
Secondary structure (Cloverleaf model) | >W1511589793 Ala TGC t ACCA tttaagggtc G - C G - C G + T G - C G + T T - A A - T T A T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |