Sequence ID | >W1511590225 |
Genome ID | LBGU01000004 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Sphingobacterium sp. Ag1 [LBGU] |
Start position on genome | 2098 |
End posion on genome | 2172 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gaaaaagtaa |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGCTAGAGCACCTGCCTTGCACGCAGGGGGTCAACGGTTCGAA |
Downstream region at tRNA end position |
ctccgggagg |
Secondary structure (Cloverleaf model) | >W1511590225 Ala TGC a ACat ctccgggagg G - C G - C G + T G - C A - T A - T T - A T A T T T G C C A C G A A | | | | | G T C T C G A A C G G C G | | | | T T G G A G C C T A A GGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |