Sequence ID | >W1511590870 |
Genome ID | LBHF01000010 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus CT4287 [LBHF] |
Start position on genome | 50948 |
End posion on genome | 50873 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ctgttgatat |
tRNA gene sequence |
GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCACGAGTTCGAAC |
Downstream region at tRNA end position |
cttttcttta |
Secondary structure (Cloverleaf model) | >W1511590870 Gly GCC t TCCA cttttcttta G - C C - G G - C A - T C - G A - T C - G C A T T G C T C A T G A A | | | | | G T C T C G A C G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |