Sequence ID | >W1511595181 |
Genome ID | LBMP01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfocarbo indianensis SCBM [LBMP] |
Start position on genome | 314736 |
End posion on genome | 314639 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
attttgccgt |
tRNA gene sequence |
GGAAGTGGAAGGCTCACTGGTGGGGCCCCCGGACTTCAAATCCGGTGTGCCGTCTGAGTA |
Downstream region at tRNA end position |
aagtgaaaac |
Secondary structure (Cloverleaf model) | >W1511595181 SeC TCA t GCCA aagtgaaaac G - C G - C A - T A - T G - C T - A G - C G G T T A T A C C C A C A C A + | | | | G T T C G G G T G G G C G + | | | T T G G G C C T G G C TGTGCCGTCTGAGTAAGGCGGCAG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |