Sequence ID | >W1511595192 |
Genome ID | LBMP01000003 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfocarbo indianensis SCBM [LBMP] |
Start position on genome | 471281 |
End posion on genome | 471205 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gaaccgccgt |
tRNA gene sequence |
CGGGACGTGGCGCAGTATGGGAGCGCACTTGAATGGGGTTCAAGGGGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
aaggcaaaca |
Secondary structure (Cloverleaf model) | >W1511595192 Pro GGG t ACCA aaggcaaaca C - G G - C G - C G - C A - T C - G G - C T A T T G A C C A T G A G + | | | | A A C G C G G C T G G C T | | | | T T G G C G C G G A A GGGTC C - G T - A T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |