Sequence ID | >W11150808 |
Genome ID | AEWE01000035 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. TJI-51 [AEWE] |
Start position on genome | 11771 |
End posion on genome | 11699 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aatgcttggt |
tRNA gene sequence |
GTCTCCTTAGTTTAACGGATAGAACAAGCCCCTCCTAAGGGCTAGATGCTGGTTCGATTC |
Downstream region at tRNA end position |
catctcaagc |
Secondary structure (Cloverleaf model) | >W11150808 Arg CCT t GCat catctcaagc G - C T - A C - G T + G C - G C - G T - A T T T C G A C C A C A A A | | | | | G G T T T G G C T G G C G + | | | T T A G A A C T A A AGAT A - T G - C C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |