Sequence ID | >W11152875 |
Genome ID | AEYZ01000216 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhizobium etli CNPAF512 [AEYZ] |
Start position on genome | 9393 |
End posion on genome | 9319 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaagctctgg |
tRNA gene sequence |
TGGGGCGTAGCCAAGCGGTAAGGCAGCGGTTTTTGGTACCGCCATCCCCTGGTTCGAATC |
Downstream region at tRNA end position |
cttctcccct |
Secondary structure (Cloverleaf model) | >W11152875 Gln TTG g GCCA cttctcccct T - A G - C G - C G - C G - C C - G G - C T A T G G A C C A G A A | | | | | G C A C C G C C T G G C G | | | T T G A G G C T A A CATCC G - C C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |