Sequence ID | >W1511656936 |
Genome ID | LEKT01000050 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Megasphaera cerevisiae DSM 20462 [LEKT] |
Start position on genome | 17264 |
End posion on genome | 17188 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
agtcaggtga |
tRNA gene sequence |
CGGGGCGTAGCGCAGTTTGGTAGCGCGCTTGGTTCGGGACTAAGAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
tacatttaca |
Secondary structure (Cloverleaf model) | >W1511656936 Pro CGG a ACCA tacatttaca C - G G - C G - C G - C G - C C - G G - C T A T T G T C C A T G A A + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC C - G T - A T - A G + T G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |