Sequence ID | >W1511693611 |
Genome ID | LFZX01000074 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas rubra OCN096 [LFZX] |
Start position on genome | 15872 |
End posion on genome | 15948 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tctttgcgcc |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGAAGGTTCGAA |
Downstream region at tRNA end position |
ttttaaaatc |
Secondary structure (Cloverleaf model) | >W1511693611 Arg TCT c GCCA ttttaaaatc G - C C - G G + T C - G C - G C - G G - C T A T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C A T A A CGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |