Sequence ID | >W1511695537 |
Genome ID | LGCV01000411 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces rimosus subsp. pseudoverticillatus NRRL WC-3896 [LGCV] |
Start position on genome | 25227 |
End posion on genome | 25154 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ttcatcgctc |
tRNA gene sequence |
GCCCCAATAGCTCAGTCGGCAGAGCGTCTCCATGGTAAGGAGAAGGTCTACGGTTCGATT |
Downstream region at tRNA end position |
atgtgtgagg |
Secondary structure (Cloverleaf model) | >W1511695537 Thr GGT c TCtg atgtgtgagg G - C C - G C - G C - G C - G A - T A - T T T T A T G C C A T G A A | | | | | G C C T C G T A C G G C G | | | | T T G G A G C C A G AGGTC T - A C - G T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |