Sequence ID | >W1511697726 |
Genome ID | LGED01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Saccharothrix sp. NRRL B-16348 [LGED] |
Start position on genome | 380287 |
End posion on genome | 380360 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gcccccgtga |
tRNA gene sequence |
GGGGACGTAGCTCAATTGGCAGAGCACCGCCTTTGCAAGGCGGGGGTTAGGGGTTCGATT |
Downstream region at tRNA end position |
gggggcgagc |
Secondary structure (Cloverleaf model) | >W1511697726 Ala TGC a ACtc gggggcgagc G - C G - C G + T G - C A - T C - G G - C T T T T C C C C A T A A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C C A A GGGTT C - G C - G G - C C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |