Sequence ID | >W1511707008 |
Genome ID | LGUT01003244 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces varsoviensis NRRL B-3589 [LGUT] |
Start position on genome | 122 |
End posion on genome | 196 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccacctccaa |
tRNA gene sequence |
GGACGATTAGCTCAGCGGGAGAGCGCTTCCCTGACACGGAAGAGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
ggacccgcga |
Secondary structure (Cloverleaf model) | >W1511707008 Val GAC a ACCG ggacccgcga G - C G - C A - T C - G G - C A - T T - A C T T T G A C C A G A A | | | | | A C C T C G A C T G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |