Sequence ID | >W11167764 |
Genome ID | AFNL01000023 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Aliarcobacter butzleri 7h1h [AFNL] |
Start position on genome | 71029 |
End posion on genome | 71105 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttataaaat |
tRNA gene sequence |
GTCAAGGTAGCTCAGCTGGTTAGAGCGCTGGTCTCATAAGCCGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
tttaagtgtg |
Secondary structure (Cloverleaf model) | >W11167764 Met CAT t ACCA tttaagtgtg G - C T - A C - G A - T A - T G - C G + T T G T C T C C C A C G A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C T T A G AGGTC C - G T + G G - C G - C T + G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |